View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_high_90 (Length: 273)
Name: NF3726_high_90
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_high_90 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 23 - 266
Target Start/End: Original strand, 52998458 - 52998701
Alignment:
| Q |
23 |
tatatagagatatagcagaatgatagtcatattcagatataaattttggtcgataaaatattaattggtagagaatcatattgatatggaggattggtat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52998458 |
tatatagagatatagcagaatgatagtcatattcagatataaattttggtcgataaaatattaattggtagagaatcatattgatatggaggattggtat |
52998557 |
T |
 |
| Q |
123 |
ttctatctgcagaattaactactagctagttagacatttttgtttttcattcaattcccatgttctaaggtcaatattaatcccaaatatatacaatctc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52998558 |
ttctatctgcagaattaactactagctagttagacatttttgtttttcattcaattcccatgttctaaggtcaatattaatcccaaatatatacaatctc |
52998657 |
T |
 |
| Q |
223 |
atcatgtagctaatgcaaccgcgtcttgttctttgttcatctct |
266 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52998658 |
atcatgtacctaatgcaaccgcgtcttgttctttgttcttctct |
52998701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University