View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_100 (Length: 263)
Name: NF3726_low_100
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_100 |
 | |
|
| [»] scaffold0037 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0037 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: scaffold0037
Description:
Target: scaffold0037; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 106 - 248
Target Start/End: Original strand, 33230 - 33372
Alignment:
| Q |
106 |
cttttcgaattcttattgctccataatataannnnnnncttccttgttgctaaaatgaacttttaataccnnnnnnncgtttagatgagatgacacgggt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33230 |
cttttcgaattcttattgctccataatataatttttttcttccttgttgctaaaatgaacttttaataccaaaaaaacgtttagatgagatgacacgggt |
33329 |
T |
|
| Q |
206 |
catttctaatttaattaaggtattgagttcgaatccagtcttg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33330 |
catttctaatttaattaaggtattgaattcgaatccagtcttg |
33372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0037; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 7 - 63
Target Start/End: Original strand, 33131 - 33187
Alignment:
| Q |
7 |
gcagcagagatgagaaagaaaggcaatgtggttttaagctctcaacctacgaacaca |
63 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33131 |
gcagcagtgatgagaaagaaaggcaatgtggttttaagctgtcaacctacgaacaca |
33187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 243
Target Start/End: Original strand, 278380 - 278440
Alignment:
| Q |
183 |
cgtttagatgagatgacacgggtcatttctaatttaattaaggtattgagttcgaatccag |
243 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| |||| |||||| ||||||| |||||||| |
|
|
| T |
278380 |
cgtttagatgagatgacacgagtctcttctagcttaactaaggtcttgagtttgaatccag |
278440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 43
Target Start/End: Original strand, 10427477 - 10427505
Alignment:
| Q |
15 |
gatgagaaagaaaggcaatgtggttttaa |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10427477 |
gatgagaaagaaaggcaatgtggttttaa |
10427505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 243
Target Start/End: Complemental strand, 31107646 - 31107586
Alignment:
| Q |
183 |
cgtttagatgagatgacacgggtcatttctaatttaattaaggtattgagttcgaatccag |
243 |
Q |
| |
|
|||||||||||||||| | ||||| |||||| |||| |||||| ||||||||||||||| |
|
|
| T |
31107646 |
cgtttagatgagatgaaatgggtctcttctaacttaactaaggttctgagttcgaatccag |
31107586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University