View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_102 (Length: 262)
Name: NF3726_low_102
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_102 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 185 - 249
Target Start/End: Original strand, 27538290 - 27538354
Alignment:
| Q |
185 |
acaatgtcttctcgaggttactatgtattagagcattgataatagtttttatttgtgttttacct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27538290 |
acaatgtcttctcgaggttactatgtattaaagcattgataatagtttttatttgtgttttacct |
27538354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 186 - 246
Target Start/End: Original strand, 28971733 - 28971794
Alignment:
| Q |
186 |
caatgtcttctcgaggttactatgtattagagcattgataatagt-ttttatttgtgtttta |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
28971733 |
caatgtcttctcgaggttactatgtattagagcattgctaatagtcttttatttgtgtttta |
28971794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 80 - 189
Target Start/End: Complemental strand, 32712289 - 32712182
Alignment:
| Q |
80 |
acaactccgcctagcaccaacatttcatggcgtcgtaaatcatctgatagaatatgtatcctgcctgttgctggaaaatgggaa--agaaacccctttga |
177 |
Q |
| |
|
||||||||||||||||| || |||||||||| || ||||| ||| |||||||||||||||||| |||||||||| | |||| | ||| ||||||| |
|
|
| T |
32712289 |
acaactccgcctagcacgaagatttcatggcttcataaattatcggatagaatatgtatcctg----ttgctggaaagtaggaagaaaaaaaacctttga |
32712194 |
T |
 |
| Q |
178 |
ttacagaacaat |
189 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32712193 |
ttacagaacaat |
32712182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University