View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3726_low_116 (Length: 251)

Name: NF3726_low_116
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3726_low_116
NF3726_low_116
[»] chr4 (1 HSPs)
chr4 (8-251)||(38480039-38480282)


Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 8 - 251
Target Start/End: Original strand, 38480039 - 38480282
Alignment:
8 aagcaaaggcagtgtgaatggtgtattcaggtagcttcagaaaatatactgagtaattcccttgctcttgctttattgaacagaaacttgattgattgct 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38480039 aagcaaaggcagtgtgaatggtgtattcaggtagcttcagaaaatatactgagtaattcccttgctcttgctttattgaacagaaacttgattgattgct 38480138  T
108 gtggatgcaggactgtgctcatagcgaacaatgtatctcttctcaacaaagaggctaatgctccaatctacagccctgaagaccttaaaaatataaaaaa 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
38480139 gtggatgcaggactgtgctcatagcgaacaatgtatctcttctcaacaaagaggctaatgctccaatctacagccctgaagaccttaaaaacataaaaaa 38480238  T
208 gatagctgaaagagatgatacatttgatcttcttggtaattcac 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
38480239 gatagctgaaagagatgatacatttgatcttcttggtaattcac 38480282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University