View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_119 (Length: 250)
Name: NF3726_low_119
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_119 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 4 - 238
Target Start/End: Complemental strand, 9214399 - 9214170
Alignment:
| Q |
4 |
gcaggaccacagaagagtttaatgctggacacgctcctggtgcaattaacataccttatatgtacaaagttggatcaggttctaattcaattctcaaaca |
103 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9214399 |
gcaggaccacggaagagtttaatgctggacacgctcctggtgcaattaacataccttatatgtacaaagttggatcaggttctaattcaattctcaaaca |
9214300 |
T |
|
| Q |
104 |
ctatgttaaattattgttgattgtcataagtctaagagatataataatactcttagccattagatcaatcaaacgaaacgactgaggtttgatagaatag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9214299 |
ctatgttaaattattgttgattgtcataagtctaagagatataataatactcttagccattagatcaatcaa-----acgactgaggtttgatagaatag |
9214205 |
T |
|
| Q |
204 |
gttgtaattgtaagagatcaaattgataatccatt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9214204 |
gttgtaattgtaagagatcaaattgataatccatt |
9214170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University