View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_122 (Length: 249)
Name: NF3726_low_122
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_122 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 44671230 - 44670989
Alignment:
| Q |
1 |
tattattgatggggaaggttgaaggcaaaaagaaacagagaaatgaagaaatgttaataagtaatatccata------------ttagggaggaggatta |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
44671230 |
tattattgatggggaaggttgaaggcaaaaagaaacagagaaatgaagaaatgttaataagtaataaccatagtcgatatcatattagggaggaggatta |
44671131 |
T |
 |
| Q |
89 |
aattaaattgtattaatcaatcccttttaggttgtgaaataaactactacggaacgtgatggttttattatgcaccttgcatttcctccccctactttct |
188 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44671130 |
aattaaattgtattaatctatcccttttaggttg--aaataaactactacggaacgtcatggttttattatgcaccttgcatttcctccccctactttct |
44671033 |
T |
 |
| Q |
189 |
tattgatgaactctggtcattcttgggatttagattcatgatct |
232 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44671032 |
tcttgatgaactctggtcattcttgggatttagattcatgatct |
44670989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University