View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_124 (Length: 249)
Name: NF3726_low_124
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_124 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 10 - 249
Target Start/End: Complemental strand, 48416747 - 48416508
Alignment:
| Q |
10 |
caaaggcaacatttaactcgatcgtgattcggtggtgtaataaagcaggcaattttcatattattagatctcgatcattaattaaaattcgaacggttca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48416747 |
caaaggcaacatttaactcgatcgtgattcggtggtgtaataaagcacgcaattttcatattattagatctcgatcattaattaaaattcgaccggttca |
48416648 |
T |
|
| Q |
110 |
aattaatatagttataaaatctttctaaacggtctcaatcacatgttttagattggatggtcttgatttgttacgtgttacaacatctcatctatctatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48416647 |
aattaatatagttataaaatctttctaaacgatctcaatcacatgttttagattggatggtcttgatttgttacgtgttacaacatcccatctatctatg |
48416548 |
T |
|
| Q |
210 |
atgttaataattatgactttactttatgggattcaacacc |
249 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48416547 |
gtgttaataattatggctttactttatgggattcaacacc |
48416508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 77 - 183
Target Start/End: Complemental strand, 35003536 - 35003430
Alignment:
| Q |
77 |
atctcgatcattaattaaaattcgaacggttcaaattaatatagttataaaatctttctaaacggtctcaatcacatgttttagattggatggtcttgat |
176 |
Q |
| |
|
||||||| ||||||||||| | ||| ||||||||| ||| | |||||||||| ||| || | |||||| |||||||||||||| ||||| || |||| |
|
|
| T |
35003536 |
atctcgaccattaattaaagattgaatggttcaaatcaatgcaattataaaatcattcaaaccaatctcaaccacatgttttagatcggatgatcctgat |
35003437 |
T |
|
| Q |
177 |
ttgttac |
183 |
Q |
| |
|
||||||| |
|
|
| T |
35003436 |
ttgttac |
35003430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University