View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_128 (Length: 245)
Name: NF3726_low_128
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_128 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 46 - 245
Target Start/End: Complemental strand, 3018634 - 3018437
Alignment:
| Q |
46 |
ggcaaattgacgaatcaggatatgagcatcctcttgctgacatgcaatgtatggatgcgaaatggcaaaataccatcttatgtattcaattgttgtcttt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3018634 |
ggcaaattgacgaatcaggatatgagcatcctcctgctgacatgcaatgtatggatgcgaaatggcaaaataccatcttatgtattcaattgttgtcttt |
3018535 |
T |
|
| Q |
146 |
agaccaatcggagcaggcatacccaaatctcaccgatttaacacataatcaagatattgcgctagttgtgttcaccttgggatttgcactcttatgtgga |
245 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3018534 |
agaccagtcggagcaggcatacccaaatctcactgatttaacacataatcaagatattatgctagt--tgttcaccttgggatttgcactcttatgtgga |
3018437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 3018692 - 3018658
Alignment:
| Q |
1 |
cacagaggcagaatatgtgtttactgcataacacc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3018692 |
cacagaggcagaatatgtgtttactgcataacacc |
3018658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University