View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_131 (Length: 241)
Name: NF3726_low_131
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_131 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 88 - 223
Target Start/End: Complemental strand, 42206013 - 42205878
Alignment:
| Q |
88 |
atgacaaataactcacacaaacggaaaataaaacgtcagctatgtcaatgatgagaaagtcaaattgtagaacagtaggaagactcaaacacagacaccg |
187 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
42206013 |
atgacaaataactcacacaaatggaaaataaaacgtcagctatgtcaatgatgagaaagtcaaattgtagaatagtacgaagactcaaacacagacaccg |
42205914 |
T |
|
| Q |
188 |
gacacgacattgacatgccaacaccaataataattt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42205913 |
gacacgacattgacatgccaacaccaataataattt |
42205878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 42206113 - 42206045
Alignment:
| Q |
1 |
ccttgtgcatggtgcaagacatatgtcttttgtgcaccatagacttgtctgtgttatagattataataa |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42206113 |
ccttgtgcatggtgcaagacatatgtcttttgtgcaccatagacttgtctgtgttatagattataataa |
42206045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University