View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_137 (Length: 238)
Name: NF3726_low_137
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_137 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 9214021 - 9213803
Alignment:
| Q |
1 |
taagtgcatgagattatgcatgttattttcaagtactccaacttaattcatctgccaatgtaaattaatgttgttgtttttgcagggttgtcagcttggg |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9214021 |
taagtgcatgagattatgtatgttattttcaagtactccaacttaattcatctgctaatgtaaattaatgttattgtttttgcagggttgtcagcttggg |
9213922 |
T |
 |
| Q |
101 |
aaaaggtctatgatggctgctactgacttgttagctgctgtaagcatttcttctttcaattgctaatatttacagtgcaatagttgattgctgcagttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
9213921 |
aaaaggtctatgatggctgctactgacttgttagctgctgtaagcatttcttctttcaattgctaatatttacattgcagtagttgat---tgcagttga |
9213825 |
T |
 |
| Q |
201 |
aaaaagtttcctagtttgtttg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
9213824 |
aaaaagtttcctagtttgtttg |
9213803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University