View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_142 (Length: 231)
Name: NF3726_low_142
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_142 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 9 - 213
Target Start/End: Complemental strand, 19856542 - 19856338
Alignment:
| Q |
9 |
gaggagcagagacagtagcaatattactagaatggattttggctagaatggtgcttcatccagagatacaagcaaaagtacaagaagaaatttaccgtgt |
108 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19856542 |
gaggaacagacacagtagcaatattactagaatggattctggctaggatggtgcttcatccagagatacaagcaaaagcacaagaagaaatttaccgtgt |
19856443 |
T |
|
| Q |
109 |
tgttggaaattccaaagttatcaatgatgctgatgttcaaaaaatgtgttacttgcaatgcattgtgaaggaagcattaagagtgcatccaccaggacca |
208 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19856442 |
tgttggaaattccaaagttatcactgatgctgatgttcaaaaaatgtgttacttacagtgcattgtgaaggaagcattaagagtgcatccaccaggacca |
19856343 |
T |
|
| Q |
209 |
ctttt |
213 |
Q |
| |
|
||||| |
|
|
| T |
19856342 |
ctttt |
19856338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University