View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_143 (Length: 230)
Name: NF3726_low_143
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_143 |
 |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0041 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 14 - 214
Target Start/End: Original strand, 111536 - 111741
Alignment:
| Q |
14 |
caaaggttagttagctagtcatcatagcactttggtctttagttttaattaattaagattctttccatatgaaatgagctcatatccacttttatgtatc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||| |
|
|
| T |
111536 |
caaaggttagttagctagtcatcatagcactttggtctttagttttaattaattaagattctttccatatgaaatgagctcatatccacctgtatatatc |
111635 |
T |
 |
| Q |
114 |
atcaaatcatgctatgaataaataattagtgtattgttaat------gtattctttattagttgttaagttaatatttttctcgttcaactgaatttgtt |
207 |
Q |
| |
|
||||||||||||||||| || ||| || ||| ||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
111636 |
atcaaatcatgctatgattagtgtatt-gttaattattaatcagctggtattctttattagttgttaagttaatatttttctcattcaactgaatttgtt |
111734 |
T |
 |
| Q |
208 |
gaattct |
214 |
Q |
| |
|
||||||| |
|
|
| T |
111735 |
gaattct |
111741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 41143775 - 41143570
Alignment:
| Q |
14 |
caaaggttagttagctagtcatcatagcactttggtctttagttttaattaattaagattctttccatatgaaatgagctcatatccacttttatgtatc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||| |
|
|
| T |
41143775 |
caaaggttagttagctagtcatcatagcactttggtctttagttttaattaattaagattctttccatatgaaatgagctcatatccacctgtatatatc |
41143676 |
T |
 |
| Q |
114 |
atcaaatcatgctatgaataaataattagtgtattgttaat------gtattctttattagttgttaagttaatatttttctcgttcaactgaatttgtt |
207 |
Q |
| |
|
||||||||||||||||| || ||| || ||| ||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41143675 |
atcaaatcatgctatgattagtgtatt-gttaattattaatcagctggtattctttattagttgttaagttaatatttttctcattcaactgaatttgtt |
41143577 |
T |
 |
| Q |
208 |
gaattct |
214 |
Q |
| |
|
||||||| |
|
|
| T |
41143576 |
gaattct |
41143570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University