View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_146 (Length: 225)
Name: NF3726_low_146
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_146 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 14 - 215
Target Start/End: Complemental strand, 24568210 - 24568011
Alignment:
| Q |
14 |
atcatatattacatgttcattcatatgtacatccccatgcacattatacattactgcaacacgtgnnnnnnnnntaaaacttgtgcagttattgtgcatt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24568210 |
atcatatattacatgttcattcatatgtacatccccatgcacattatacattactgcaacacgtgcaaaaaaaataaaacttgtgcagttattgtgcatt |
24568111 |
T |
 |
| Q |
114 |
caattgccttaaatttatgnnnnnnnnnnngtgtgaatttgttgtagaatattctgcaaaatggttcccttttgtgtaacatatttattatcctatgcta |
213 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
24568110 |
caattaccttaaatttatg--tttttttttgtgtgaatttgttgtagaatattctgcaaaatggttcccttttgtgcaacatatttattatcctatacta |
24568013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University