View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_148 (Length: 218)
Name: NF3726_low_148
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_148 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 201
Target Start/End: Original strand, 37727855 - 37728043
Alignment:
| Q |
13 |
caaaggcatatgatgcacatgaacccccaacccaaaagaaagaaaatcgattatgcaatgcttaacttcctacttcatacaacacttgtcatatatatgg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37727855 |
caaaggcatatgatgcacatgaacccccaacccaaaagaaagaaaatcgattatgcaatgcttaacttcctacttcatacaacacttgtcatatatatgg |
37727954 |
T |
|
| Q |
113 |
atatacataatgcttaatcttttggatggcctttgggaagatagataatgcatcagacattgaacgattatagggattgtgtcatttac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37727955 |
atatacataatgcttaatcttttggatggcctttgggaagatagataatgcatcagacattgaacgattattgggattgtgtcatttac |
37728043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University