View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_149 (Length: 215)
Name: NF3726_low_149
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_149 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 36695083 - 36695269
Alignment:
| Q |
13 |
aagaatatgttaaccaacacagaaattaatccaccaactagaattgttgttaccctatcttgtgcagtatcaattatctcatggtctctataacttgata |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36695083 |
aagaaaatgttaaccaacacagaaattaatccaccaactagaattgttgttaccctatcttgtgcagtatcaattatctcatggtctctataacttgata |
36695182 |
T |
|
| Q |
113 |
cagataccaaacaaaatgtcaagataaacactagcaaaccataatcatatcttgccttcattagaggtataaatcgaatatatgtag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36695183 |
cagataccaaacaaaatgtcaagataaacactagcaaaccataatcatatcttgccttcattagaggtataaatcgaatatatgtag |
36695269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University