View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3726_low_150 (Length: 215)

Name: NF3726_low_150
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3726_low_150
NF3726_low_150
[»] chr4 (1 HSPs)
chr4 (80-184)||(34693060-34693164)


Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 80 - 184
Target Start/End: Complemental strand, 34693164 - 34693060
Alignment:
80 catgttttgtcagctttactaacactgcttaatttcgttttattacactatgaagaaagaaaactgcttatttttcacgcaagtatgtgtgtagcatgat 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34693164 catgttttgtcagctttactaacactgcttaatttcgttttattacactatgaagaaagaaaactgcttatttttcacgcaagtatgtgtgtagcatgat 34693065  T
180 caatg 184  Q
    |||||    
34693064 caatg 34693060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University