View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_150 (Length: 215)
Name: NF3726_low_150
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_150 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 80 - 184
Target Start/End: Complemental strand, 34693164 - 34693060
Alignment:
| Q |
80 |
catgttttgtcagctttactaacactgcttaatttcgttttattacactatgaagaaagaaaactgcttatttttcacgcaagtatgtgtgtagcatgat |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34693164 |
catgttttgtcagctttactaacactgcttaatttcgttttattacactatgaagaaagaaaactgcttatttttcacgcaagtatgtgtgtagcatgat |
34693065 |
T |
 |
| Q |
180 |
caatg |
184 |
Q |
| |
|
||||| |
|
|
| T |
34693064 |
caatg |
34693060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University