View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_156 (Length: 201)
Name: NF3726_low_156
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_156 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 28 - 184
Target Start/End: Original strand, 37430426 - 37430582
Alignment:
| Q |
28 |
gtgaaaggcaagataaggaaatagaaaacaaaaggaccccatttagaggaaattatactctcttgtttaggattttggatttgattattttagcctatat |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||| |||||||||||||||||| ||| |
|
|
| T |
37430426 |
gtgaaaggcaagataaggaaatagaaaacaaaaggaccccatttagaggaaactatactctcttcttgaggattttttatttgattattttagcctctat |
37430525 |
T |
|
| Q |
128 |
ctatagaggttatgaagaggtttgaaagatgcagaagcatgacctacaaagcattga |
184 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37430526 |
ctatagatgttatgaagaggtttgaaagatgcagaagcatgacctactaagcattga |
37430582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 28 - 75
Target Start/End: Original strand, 37698462 - 37698509
Alignment:
| Q |
28 |
gtgaaaggcaagataaggaaatagaaaacaaaaggaccccatttagag |
75 |
Q |
| |
|
||||||||||| |||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
37698462 |
gtgaaaggcaaaataaggcaatagaataaaaaaggaccccatttagag |
37698509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University