View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_58 (Length: 347)
Name: NF3726_low_58
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 17 - 337
Target Start/End: Complemental strand, 45729439 - 45729119
Alignment:
| Q |
17 |
aaataggaggtttcatggagattatatttagtttttctggggcgatggagatggttgtcgatggtggaggatgggggtggagacggtggcgtttgatgta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45729439 |
aaataggaggtttcatggagattatatttagtttttctggggcgatggagatggttgtcaatggtggaggatggtggtggagacggtggcgtttgatgta |
45729340 |
T |
|
| Q |
117 |
tgagattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaatagagacgcatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45729339 |
tgagattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaatagagacgcatt |
45729240 |
T |
|
| Q |
217 |
atgaggggagcactgcaggtacctagggataatatgagacaatttactacgagaaggaatctcttcannnnnnnctctgcaacttgttttttaccatctt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45729239 |
atgaggggagcactgcaggtacctagggataatatgagacaatttactacgagaaggaatctcttcatttttttctctgcaacttgttttttaccatctt |
45729140 |
T |
|
| Q |
317 |
ccatgtgtgtgttcttctctg |
337 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45729139 |
ccatgtgtgtgttcttctctg |
45729119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 17 - 276
Target Start/End: Complemental strand, 45725250 - 45724991
Alignment:
| Q |
17 |
aaataggaggtttcatggagattatatttagtttttctggggcgatggagatggttgtcgatggtggaggatgggggtggagacggtggcgtttgatgta |
116 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||| | |||||| ||| | | || || ||||| |||| |||||| |
|
|
| T |
45725250 |
aaataggtggtttcatggagattatattttgtttttctgaggcgatggagatggtgttggatggtaaaggtttgtggcggtgacggaaacgttggatgta |
45725151 |
T |
|
| Q |
117 |
tgagattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaatagagacgcatt |
216 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45725150 |
tgagattgtgaggggaatgagcatcaaggggaaaccggcagtttccaggcaggcggagagccagacacgttggccgccgtggatgaaatagagacgcatt |
45725051 |
T |
|
| Q |
217 |
atgaggggagcactgcaggtacctagggataatatgagacaatttactacgagaaggaat |
276 |
Q |
| |
|
|| |||||| ||| | || ||||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
45725050 |
attaggggaccaccggagttacctagggctaatatcagacaatttactatcagaaggaat |
45724991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University