View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_71 (Length: 317)
Name: NF3726_low_71
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_71 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 17 - 305
Target Start/End: Complemental strand, 31737920 - 31737632
Alignment:
| Q |
17 |
aataagaaggtgtatggtgggatggaagggcgggcagagaagttgatggaggatattaatgggcttgatgagaagggggaggaaggtggtttgagtgatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31737920 |
aataagaaggtgtatggtgggatggaagggcgggcggagaagttgatggaggatattaatgggcttgatgagaagggggaggaaggtagtttgagtgatg |
31737821 |
T |
|
| Q |
117 |
cggaaattcttattcggaaggataagtttagtgagttatggaggcttcttaaggcgaaagatgcgatggcggtgcaaaggtcaagatctaaatggcctaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31737820 |
cggaaattcttattcggaaggataagtttagtgagttatggaggcttcttaaggcgaaagatgcgatggcggtgcaaaggtcaagatctaaatggcctaa |
31737721 |
T |
|
| Q |
217 |
ggaaggtgatgttaattctagattttttcataattgtataaaatcaagagggtcgagaaattctattaaggtcttaaaggtggatgatg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31737720 |
ggaaggtgatgttaattctagattttttcataattgtataaaatcaagagggtcgagaaattctattaaggccttaaaggtggatgatg |
31737632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 53 - 212
Target Start/End: Complemental strand, 8247754 - 8247596
Alignment:
| Q |
53 |
gagaagttgatggaggatattaatgggcttgatgagaagggggaggaaggtggtttgagtgatgcggaaattcttattcggaaggataagtttagtgagt |
152 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| |||| |||| |||||||| |||||||| ||| || ||||||||| |||| |
|
|
| T |
8247754 |
gagaagttgatggaggatattaaggggcttgatgtaaaggggg-ggaaagtgggttgagtgacatggaaattcgaggtcgtaaagataagttttgtgaac |
8247656 |
T |
|
| Q |
153 |
tatggaggcttcttaaggcgaaagatgcgatggcggtgcaaaggtcaagatctaaatggc |
212 |
Q |
| |
|
||||||||||||||||||| ||||||| || || ||| || ||||| |||||||||||| |
|
|
| T |
8247655 |
tatggaggcttcttaaggctaaagatgtgaaggtggtaaaatggtcacgatctaaatggc |
8247596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University