View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_80 (Length: 300)
Name: NF3726_low_80
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_80 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 12514539 - 12514749
Alignment:
| Q |
18 |
cattctatctaaatcttgatataatagttagtaataaatttcccatcttcttttccaccttatattatgactcatccaccaccacctcctacccccactc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12514539 |
cattctatctaaatcttgatataatagttagtaataaatttcccatcttcttttccaccttatattatgactcatccaccaccacctcctacccccactc |
12514638 |
T |
 |
| Q |
118 |
ccatacttatcttccccatgttagtctcttcaattcaatcacaatcataatcacaacttacccacctctttcttttcttcacttttctctctttgcaaag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12514639 |
ccatacttatcttccccatgttagtctcttcaattcaatcacaatcataatcacaacttacccacctctttcttttcttcactgttctctctttgcaaag |
12514738 |
T |
 |
| Q |
218 |
tacattgcaaa |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
12514739 |
tacattgcaaa |
12514749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University