View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_90 (Length: 282)
Name: NF3726_low_90
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_90 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 36170802 - 36171066
Alignment:
| Q |
18 |
ggttttatggcagaatttgttaagtttctcaatgcgaaatcatttgaagttcgcgaaatggcagctgaagcactctccggcatggtcacggtacctagaa |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170802 |
ggttttatggtagaatttgttaagtttctcaatgcgaaatcatttgaagttcgcgaaatggcagctgaagcactctccggcatggtcacggtacctagaa |
36170901 |
T |
 |
| Q |
118 |
atagaaagaggtttgttcaagatgatcataacatagccctgcttctgcaattgcttgatccagaagagggaaattcaggtaacaaaaagttcttaatctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170902 |
atagaaagaggtttgttcaagatgatcataacatagccctgcttctgcaattgcttgatccagaagagggaaattcaggtaacaaaaagttcttaatctc |
36171001 |
T |
 |
| Q |
218 |
tatcttaatgtcattgacaagttgcaatagtgcaaggaaaaagattgttagctctggttatgcca |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36171002 |
tatcttaatgtcattgacaagttgcaatagtgcaaggaaaaagattgttagctctggttatgcca |
36171066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 282
Target Start/End: Complemental strand, 1286240 - 1285976
Alignment:
| Q |
18 |
ggttttatggcagaatttgttaagtttctcaatgcgaaatcatttgaagttcgcgaaatggcagctgaagcactctccggcatggtcacggtacctagaa |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
1286240 |
ggttttatggaagaatttgttaagtttctcaatgcgaaatcatttgaagttcgagaaatggcagctgaagcactctccggcatagtcacagtacctagaa |
1286141 |
T |
 |
| Q |
118 |
atagaaagaggtttgttcaagatgatcataacatagccctgcttctgcaattgcttgatccagaagagggaaattcaggtaacaaaaagttcttaatctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1286140 |
atagaaagaggtttgttcaagatgatcataacatagccctgcttctgcaattgcttgatccagaagagggaaattcaggtaacaaaaagttcttaatctc |
1286041 |
T |
 |
| Q |
218 |
tatcttaatgtcattgacaagttgcaatagtgcaaggaaaaagattgttagctctggttatgcca |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
1286040 |
tatcttaatgtcattgacaagttgcaatagtgcacggaaaaagattgttagttctggttatgcca |
1285976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 156 - 214
Target Start/End: Complemental strand, 569628 - 569570
Alignment:
| Q |
156 |
ctgcttctgcaattgcttgatccagaagagggaaattcaggtaacaaaaagttcttaat |
214 |
Q |
| |
|
||||| |||||||||||||||| |||||||| | || |||||||||||||||||||||| |
|
|
| T |
569628 |
ctgctgctgcaattgcttgatctagaagaggaacatacaggtaacaaaaagttcttaat |
569570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University