View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_low_98 (Length: 266)
Name: NF3726_low_98
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_low_98 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 9587073 - 9586870
Alignment:
| Q |
1 |
tgccaacatgtcccttaacccctcttcaactttggagatagtgtgtggtggagtctttttggtgtgcttttgttttcatgtnnnnnnnctcatttacttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
9587073 |
tgccaacatgtcccttaacccctcttcaactttggagatagtgtgtggtggagtcttttttgtgtgcttttgttttcatgtaaaaaaactcatttacttt |
9586974 |
T |
 |
| Q |
101 |
ttccttttagatttagttcttgagtttaaagctatatcttaaaaatgggacctaaatagttggttcaa-nnnnnnnggttacaaaatagttggttcaatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9586973 |
ttccttttagatttagttcttgagtttaaagcaatatcttaaaaatgggacctaaatagttggttcaattttttttggttacaaaatagttggttcaatt |
9586874 |
T |
 |
| Q |
200 |
gaga |
203 |
Q |
| |
|
|||| |
|
|
| T |
9586873 |
gaga |
9586870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 200 - 259
Target Start/End: Complemental strand, 9586803 - 9586744
Alignment:
| Q |
200 |
gagattaagttttccatcaactataaattagggatggtaagagccaactcatctctgctc |
259 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| |||||||||||| ||||||||| |
|
|
| T |
9586803 |
gagattaagttctccatcaactataaattaaggatggcaagagccaactcgtctctgctc |
9586744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University