View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3727-Insertion-19 (Length: 121)
Name: NF3727-Insertion-19
Description: NF3727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3727-Insertion-19 |
 | |
|
| [»] chr2 (5 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 2e-53; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 8 - 121
Target Start/End: Original strand, 7348754 - 7348867
Alignment:
| Q |
8 |
gactcaactctagaagggatttcgatcatcaactcctccgggagaatcgtgttcggtgactccgccgtgacttccgccatcagcgccaacattcaatttt |
107 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7348754 |
gactcaactctagaaaggatttcgatcatcaactcctccgggagaattgtgttcggtgactccgccgtgacttccgccatcagcgccaacattcaatttt |
7348853 |
T |
|
| Q |
108 |
tgagattttaggga |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7348854 |
tgagattttaggga |
7348867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 11 - 88
Target Start/End: Complemental strand, 7908058 - 7907981
Alignment:
| Q |
11 |
tcaactctagaagggatttcgatcatcaactcctccgggagaatcgtgttcggtgactccgccgtgacttccgccatc |
88 |
Q |
| |
|
|||| ||||||| |||||||||| |||| ||||||||||| ||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
7908058 |
tcaaatctagaaaggatttcgataatcagatcctccgggagtatcgtgttctgtgactccgccgtggcttccgccatc |
7907981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 11 - 89
Target Start/End: Original strand, 7365886 - 7365964
Alignment:
| Q |
11 |
tcaactctagaagggatttcgatcatcaactcctccgggagaatcgtgttcggtgactccgccgtgacttccgccatca |
89 |
Q |
| |
|
|||||||||| | ||||||||||||||| ||| |||||||||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
7365886 |
tcaactctagcaaggatttcgatcatcagttccaccgggagaatcgtggtcggtgactccgccgttgcatccgccatca |
7365964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 7342265 - 7342315
Alignment:
| Q |
8 |
gactcaactctagaagggatttcgatcatcaactcctccgggagaatcgtg |
58 |
Q |
| |
|
|||||||| |||||| ||||||| |||||||| ||||| |||||||||||| |
|
|
| T |
7342265 |
gactcaaccctagaaaggatttcaatcatcaattcctctgggagaatcgtg |
7342315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 11 - 88
Target Start/End: Complemental strand, 6828681 - 6828604
Alignment:
| Q |
11 |
tcaactctagaagggatttcgatcatcaactcctccgggagaatcgtgttcggtgactccgccgtgacttccgccatc |
88 |
Q |
| |
|
||||| ||| || ||||||| ||||||| ||||||||||||||||| ||||||||||| | || ||||||||||| |
|
|
| T |
6828681 |
tcaaccctataaaggatttcaatcatcacttcctccgggagaatcgtagtcggtgactccacggttgcttccgccatc |
6828604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University