View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3727-Insertion-21 (Length: 85)

Name: NF3727-Insertion-21
Description: NF3727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3727-Insertion-21
NF3727-Insertion-21
[»] chr7 (3 HSPs)
chr7 (9-85)||(32095943-32096019)
chr7 (9-85)||(32091858-32091934)
chr7 (14-85)||(29887809-29887880)


Alignment Details
Target: chr7 (Bit Score: 73; Significance: 5e-34; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 5e-34
Query Start/End: Original strand, 9 - 85
Target Start/End: Original strand, 32095943 - 32096019
Alignment:
9 taatattaaccaagaccaagcattggatataaaatgaaattcctaactaactaccatgaatagctaaatacgaagta 85  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32095943 taatcttaaccaagaccaagcattggatataaaatgaaattcctaactaactaccatgaatagctaaatacgaagta 32096019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 9 - 85
Target Start/End: Original strand, 32091858 - 32091934
Alignment:
9 taatattaaccaagaccaagcattggatataaaatgaaattcctaactaactaccatgaatagctaaatacgaagta 85  Q
    |||| ||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||| |||||    
32091858 taatcttaaccaagaccaagcattggttataaaatgaatttcctaactaaccaccatgaatagctaaatactaagta 32091934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 14 - 85
Target Start/End: Complemental strand, 29887880 - 29887809
Alignment:
14 ttaaccaagaccaagcattggatataaaatgaaattcctaactaactaccatgaatagctaaatacgaagta 85  Q
    |||||||| |||||||||| ||||||  ||||||||||||  |||| ||||||||||||||||||| |||||    
29887880 ttaaccaataccaagcattagatatattatgaaattcctatgtaaccaccatgaatagctaaatacaaagta 29887809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University