View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3727-Insertion-21 (Length: 85)
Name: NF3727-Insertion-21
Description: NF3727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3727-Insertion-21 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 5e-34; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 5e-34
Query Start/End: Original strand, 9 - 85
Target Start/End: Original strand, 32095943 - 32096019
Alignment:
| Q |
9 |
taatattaaccaagaccaagcattggatataaaatgaaattcctaactaactaccatgaatagctaaatacgaagta |
85 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32095943 |
taatcttaaccaagaccaagcattggatataaaatgaaattcctaactaactaccatgaatagctaaatacgaagta |
32096019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 9 - 85
Target Start/End: Original strand, 32091858 - 32091934
Alignment:
| Q |
9 |
taatattaaccaagaccaagcattggatataaaatgaaattcctaactaactaccatgaatagctaaatacgaagta |
85 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
32091858 |
taatcttaaccaagaccaagcattggttataaaatgaatttcctaactaaccaccatgaatagctaaatactaagta |
32091934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 14 - 85
Target Start/End: Complemental strand, 29887880 - 29887809
Alignment:
| Q |
14 |
ttaaccaagaccaagcattggatataaaatgaaattcctaactaactaccatgaatagctaaatacgaagta |
85 |
Q |
| |
|
|||||||| |||||||||| |||||| |||||||||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
29887880 |
ttaaccaataccaagcattagatatattatgaaattcctatgtaaccaccatgaatagctaaatacaaagta |
29887809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University