View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3727_low_12 (Length: 265)
Name: NF3727_low_12
Description: NF3727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3727_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 10094128 - 10094347
Alignment:
| Q |
18 |
caatacacaacccacaagatacggtaagtgatatagttcatgctaagttttttcaattcaatggaccaaaatagcatcaatgaaattattaatgttgtct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10094128 |
caatacacaacccacaagatacggtaagtgatatagttcatgctaagttttttcaattcaatggaccaaaatagcatcaatgaaattattaatgttgtct |
10094227 |
T |
 |
| Q |
118 |
cactttttctactatt--tgtgcaaattttaatgaaagttctttactaaagtagtatatattggtccccttagaagatgcctttgtcagtttaactctat |
215 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10094228 |
cactttttctactattagtgtgcaaattttaatgaaagttctttactaaagtagtatatattggtccccttagaagatgcctttgtcagtttaactctat |
10094327 |
T |
 |
| Q |
216 |
agtttcattaattattttcc |
235 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
10094328 |
agtttcattaattattttcc |
10094347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University