View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3728_low_33 (Length: 247)
Name: NF3728_low_33
Description: NF3728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3728_low_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 6 - 226
Target Start/End: Complemental strand, 2311369 - 2311139
Alignment:
| Q |
6 |
tcaatagtggcatagtagaaattgaaggaattctatgtgttataatagaagttgaaggaattgtagtcacgattcaattgataagagaggatgggggtgg |
105 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2311369 |
tcaatagtggcatagtataaattgaaggaattctatgtgatataatagaagttgaaggaattgtagtcacgattcaattgataagagaggatgggcgtgg |
2311270 |
T |
|
| Q |
106 |
ggcttatatagcataaggaagatagagaaggaaagattataaataaaatatacacaattatgagcttcaatct--------ccagttaaaggtttttgtc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
2311269 |
ggcttatatagcataaggaagatagagaagggatgattataaatcaaatatacacaattatgagcttcaatctttgtgtaaccagttaaaggtttgtgtc |
2311170 |
T |
|
| Q |
198 |
ta--tatagtgtgtgcactactgtgtattgt |
226 |
Q |
| |
|
|| ||||||||||||||||||||||||||| |
|
|
| T |
2311169 |
tatctatagtgtgtgcactactgtgtattgt |
2311139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University