View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3729_high_9 (Length: 296)
Name: NF3729_high_9
Description: NF3729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3729_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 115 - 239
Target Start/End: Original strand, 32951023 - 32951147
Alignment:
| Q |
115 |
tattcagccttcttaatttcatgttcagcttcaatcattctcaattcagctctctctatttgaacttcagccaattcctcctcttcaggtttcgtcattc |
214 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32951023 |
tattcagccatcttaatttcatgttcagcttcaatcattctcaattcagctctctctatttgaacttcagccaattcctcctcttcaggtttcgtcattc |
32951122 |
T |
|
| Q |
215 |
tgtcctcactctccttttgaatgaa |
239 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32951123 |
tgtcctcactctccttttgaatgaa |
32951147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 32950909 - 32950939
Alignment:
| Q |
1 |
tcagctttgatcatataccattcagctctct |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32950909 |
tcagctttgatcatataccattcagctctct |
32950939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University