View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3729_low_14 (Length: 248)
Name: NF3729_low_14
Description: NF3729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3729_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 56 - 231
Target Start/End: Complemental strand, 6217019 - 6216844
Alignment:
| Q |
56 |
gcttagtatgatacatcatgcgaagacattttacttttcaaactatgttaaatttagagattaaaaaagagaaaattatgtgactataattgcactctta |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6217019 |
gcttagtatgatacatcatgcgaagacattttacttttcaaactatgttaaatttagagattaaaaaagagaaaattatgtgactataattgcactctta |
6216920 |
T |
 |
| Q |
156 |
aaataattatgcatgaaatatatgtgtcacttggatataggtttcataatatgatatatacctgatgaagcatatg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6216919 |
aaataattatgcatgaaatatatgtgtcacttggatataggtttcataatatgatatatacctgatgaagcatatg |
6216844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 39
Target Start/End: Complemental strand, 6217061 - 6217032
Alignment:
| Q |
10 |
attatacttaattataaaagataaaatctc |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6217061 |
attatacttaattataaaagataaaatctc |
6217032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University