View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3729_low_7 (Length: 301)
Name: NF3729_low_7
Description: NF3729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3729_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 11 - 285
Target Start/End: Complemental strand, 54620050 - 54619774
Alignment:
| Q |
11 |
cagagacaaaatatgattctaataaattggagacaaagaaatgtctgcccataacactcctttacaccgcatacttagagctatgtattcatcattctgt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54620050 |
cagagacaaaatatgattctaataaattggagacaaagaaatgtctgcccataacactcctttacaccgcatacttagagctatgtattcatcattctgt |
54619951 |
T |
 |
| Q |
111 |
ggcttagctatcactgtctcaatcaacaccctcttattctgtccccaattggctactttatgatggtccactatccctgctctct--nnnnnnnntaaca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54619950 |
ggcttagctatcactgtctcaatcaacaccctcttattctgtccccaattggctactttatgatggtccactatccctgctctctcccccccccctaaca |
54619851 |
T |
 |
| Q |
209 |
tgttcagtgttttctttctgctttatcccaactaaatggataaggcttaattgaatcactggtttaaggttcatttg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54619850 |
tgttcagtgttttctttctgctttatcccaactaaatggataaggcttaattgaatcactggtttaaggttaatttg |
54619774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University