View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3730_high_4 (Length: 340)
Name: NF3730_high_4
Description: NF3730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3730_high_4 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 108 - 340
Target Start/End: Original strand, 11226960 - 11227192
Alignment:
| Q |
108 |
tcaagtgatgagatgtattatgggaaattggttgacatcatagaacttgattactatggtaagctgagggttgtgcttttcaagtgtatttgggtagata |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11226960 |
tcaagtgatgagatgtattatgggaaattggttgacatcatagaacttgattactatggtaagctgagggttgtgcttttcaagtgtgtttgggtagata |
11227059 |
T |
|
| Q |
208 |
ctagacctaacaagggaattaagattgatcaatttggaataccaagtgtgaatttctctcgcttgatacacactggtgtgaatgaagtagatgaatcatt |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11227060 |
ctagacctaacaagggaattaagattgatcaatttggaataccaagtgtgaatttctctagcttgatacacactggtgtgaatgaagtagatgaaccatt |
11227159 |
T |
|
| Q |
308 |
catccttgcaactgatgctagaatggtatatta |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11227160 |
catccttgcaactgatgctagaatggtatatta |
11227192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University