View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3731_high_21 (Length: 237)
Name: NF3731_high_21
Description: NF3731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3731_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 33974550 - 33974358
Alignment:
| Q |
1 |
cgtaaaatggtttatttaaaataaaacttaagatcgtctttaaaattgttctcgacactca-ttggactccctctcagataaaaccaaattggataagag |
99 |
Q |
| |
|
|||||||||||| |||||| | |||||||| |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33974550 |
cgtaaaatggttcatttaagacaaaacttatgatcgtctttaaaattgttctcgacactcacttggattccctctcagataaaaccaaattggataagag |
33974451 |
T |
 |
| Q |
100 |
atttacatttacgcttctcattagtcattacacaagtgtgacagtctaaaccatgaatgcatgagagaaatcaaattgcatgttatgacagat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33974450 |
atttacatttacgcttctcattagtcattacacaagtgtgacggtctttaccatgcatgcatgagagaaatcaaattgcatgttatgaaagat |
33974358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 221
Target Start/End: Complemental strand, 33973862 - 33973830
Alignment:
| Q |
189 |
agatgtatttatcaattcatcatggttattgtt |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
33973862 |
agatttatttatcaattcatcatggttattgtt |
33973830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University