View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3731_low_16 (Length: 290)
Name: NF3731_low_16
Description: NF3731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3731_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 20 - 277
Target Start/End: Original strand, 38280221 - 38280478
Alignment:
| Q |
20 |
gtgaggagaaaaaatgatagaatatataacatagtaattattagaaagatattttgatagaggagaagatggcgaaggattgaatgaatgttcaccttcc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38280221 |
gtgaggagaaaaaatgatagaatatataagatagtaattattagaaagatattttgatagaggagaagatggcgaaggattgaatgaatgttcaccttcc |
38280320 |
T |
 |
| Q |
120 |
ttgtacttgtaaaccaaaatgggaaggctacattttggtagtaaagtcgacaacatgtcaattcaacaatagttgctaaatcaatttaagatagacaacc |
219 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38280321 |
tagtacttgtaaaccaaaatgggaaggctacattttggtagtaaagtcgaaaacatgtcaattcaacaatagttgctaaatcaatttaagatagacaacc |
38280420 |
T |
 |
| Q |
220 |
tcatcacactgttacctttaaagttcaaaccgcgtttcattctgtttatcagtgcttc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38280421 |
tcatcacactgttacctttaaagttcaaaccgcgtttcattctgtttatcagtgcttc |
38280478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University