View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3731_low_17 (Length: 284)
Name: NF3731_low_17
Description: NF3731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3731_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 12 - 185
Target Start/End: Complemental strand, 32165468 - 32165296
Alignment:
| Q |
12 |
aacctgtgatatagttaaagacttgtctattttgatgtttattgtcattttaggaagtaatgtgaaactataaattttaagaattttgcctttgctttat |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32165468 |
aacctgtgacatagttaaagacttgtctattttgatgtttattgtcattttaggaagtaatgtgaaactataaattttaagagttttgcctttgctttat |
32165369 |
T |
|
| Q |
112 |
ttcttcttcactagttctaagatttttgctcattaaaactactttaatttgctggttttgcaggttcttaatgg |
185 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32165368 |
ttcttcttcactagtt-taagatttttgctcattaaaactactttaatttgctggttttgcaggttcttaatgg |
32165296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 182 - 284
Target Start/End: Complemental strand, 32164935 - 32164833
Alignment:
| Q |
182 |
atggttcctctttttatgattttatgcagtttaagaaaataatcacctctgtccatactccaaaatggaaatatatatggacatgttgaataaaatttca |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32164935 |
atggttcctctttttatgattttatgcagtttaagaaaataatcacctctgtccatactccaaaatggaaatatatatggacatgttgaataaaatttca |
32164836 |
T |
|
| Q |
282 |
tgc |
284 |
Q |
| |
|
||| |
|
|
| T |
32164835 |
tgc |
32164833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University