View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3731_low_20 (Length: 241)
Name: NF3731_low_20
Description: NF3731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3731_low_20 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 53435379 - 53435158
Alignment:
| Q |
20 |
gcgcatgcattaattccaccaaaacattttgatttttaatttcactttatattattattgatgaaaagaaagataaaattacaaactcaaccacggcaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53435379 |
gcgcatgcattaattccaccaaaacattttgatttttaatttcactttatgttattattgatgaaaagaaagataaaattacaaactcaaccacggcaag |
53435280 |
T |
 |
| Q |
120 |
ctacggctctatacattataatcacctattaaaatgctcaaagaaagaaaaatatcaaaactgttgtgcccaatcaaagaaattaatggataaaataacg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53435279 |
ctacggctctatacattataatcacctattaaaatgctcaaagaaagaaaaatatcaaaactgttgtacccaatcaaagaaattaatggataaaataacg |
53435180 |
T |
 |
| Q |
220 |
ttaattagcttgtaaaattgcc |
241 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
53435179 |
ttaattaggttgtaaaattgcc |
53435158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University