View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3731_low_22 (Length: 237)
Name: NF3731_low_22
Description: NF3731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3731_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 22612352 - 22612572
Alignment:
| Q |
1 |
tataattggagtagatcatattttatttgttaacttttttatattccccgggaaagaaattaggtatcttataaaacaatttagagaattcatttttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22612352 |
tataattggagtagatcatattttatttgttaacttttttatattccccgggaaagaaattaggtatcttataaaacaatttagagaattcatttttcaa |
22612451 |
T |
|
| Q |
101 |
tataaggaggaatatttaggtagttttgctttaataggcaaaaatttatatcaacaaaataaccattcaaaacacaaggtactatgaaaataattaacca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22612452 |
tataaggaggaatatttaggtagttttgcttaaataggcaaaaatttatatcaacaaaataaccattcaaaacacaaggtattatgaaaataattaacca |
22612551 |
T |
|
| Q |
201 |
atgctacaaacatagaaatag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
22612552 |
atgctacaaacatagaaatag |
22612572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University