View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3732_high_6 (Length: 390)
Name: NF3732_high_6
Description: NF3732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3732_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 203 - 373
Target Start/End: Original strand, 30352519 - 30352689
Alignment:
| Q |
203 |
gggagttgttgtgtggtgcgggaggttttgcccattattgtatttttgggtgttttgtttttgctaggaaggatattgcattgatttgtttagccccgat |
302 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| || || |||||||||||| ||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
30352519 |
gggagttgttgtgtggtgcaggaggttttgcccattattgtattcttaggcgttttgtttttgttaggaaggatattgcattggtttgtttagccctgat |
30352618 |
T |
 |
| Q |
303 |
gtagtannnnnnnncctttgatggttttggaaaatatttgtgacacccaaaatgtgtatacatcttgtctt |
373 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30352619 |
gtagtattttttttcctttgatggttttggaaaatatttgtgacacccaaaatgtgtatacatcttgtctt |
30352689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 16 - 189
Target Start/End: Original strand, 30352318 - 30352494
Alignment:
| Q |
16 |
atcattgttttctagaggtggaataagaagttttctcttaggcggcctcctgatggaggtcttgttgtgnnnnnnnnnnngtggaagtgtgacaagcttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30352318 |
atcattgttttctagaggtggaataagaagttttatctcaggcggcctcctggtggaggtcttgttgtgttttttttt--gtggaagtgtgacaagcttt |
30352415 |
T |
 |
| Q |
116 |
tgatgtt-----tgtagacttttatgtctgtgttagcttttgggcgaggatgtttttcgtgatctgcttggtttcctcg |
189 |
Q |
| |
|
||||||| ||||||||| || ||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30352416 |
tgatgttgagtttgtagacttgtaagtctgggttagcttttgggcgaggatgtttttcgtgttctgcttggtttcctcg |
30352494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University