View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3732_high_9 (Length: 322)
Name: NF3732_high_9
Description: NF3732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3732_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 16 - 259
Target Start/End: Complemental strand, 25513983 - 25513740
Alignment:
| Q |
16 |
aaaatcatgggtttttgttgattttaaattttgagctgagtagttatttttgttgttgtggaagaaggaggaaatggggcgtcgggctgccgagtttcgg |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25513983 |
aaaatcatgggtttttgttgattttgaattttgagctgagtagttgtttttgttgtggtggaagaaggaggaaatggggcgtcgggctgccgagtttcgg |
25513884 |
T |
|
| Q |
116 |
cgcccgattcgacgaaagttgtcttatgggatctgttttcttcttggagcattttctgttgtcggtttggttatggtttttgttcaacataattaccatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25513883 |
cgcccgattcgacgaaagttgtcttatgggatctgttttcttcttggagcattttctgttgtcggtttggttatggtttttgttcaacataattaccatc |
25513784 |
T |
|
| Q |
216 |
aagatcgggtccaacatacccttatggtaacattacattctccc |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25513783 |
aagatcgggtccaacatacccttatggtaacattacattctccc |
25513740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University