View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3732_low_15 (Length: 248)
Name: NF3732_low_15
Description: NF3732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3732_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 34 - 139
Target Start/End: Original strand, 11819058 - 11819167
Alignment:
| Q |
34 |
ttcacacaaaaatagcttgcaaataaaatggcacacatccaaacccagtgttgtattttcatctttgaataattga----atctatctatctagttcatt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11819058 |
ttcacacaaaaatagcttgcaaataaaatggcacacatccaaacccagtattgtatttccatctttgaataattgaatatatctatctatctagttcatt |
11819157 |
T |
|
| Q |
130 |
tgcttattat |
139 |
Q |
| |
|
|||||||||| |
|
|
| T |
11819158 |
tgcttattat |
11819167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 11819219 - 11819297
Alignment:
| Q |
160 |
gttgcatttatctccccctagatgttgtgtcagagttggtgaggatgggatggttcaacattgattagcattgcctttg |
238 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11819219 |
gttgcatttatcttcccctagattttgtgtcagagttggtgaggatgggatggttcaacattgattagcattgcctttg |
11819297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 140 - 225
Target Start/End: Original strand, 11805250 - 11805335
Alignment:
| Q |
140 |
tatatctagttcatttgcttgttgcatttatctccccctagatgttgtgtcagagttggtgaggatgggatggttcaacattgatt |
225 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11805250 |
tatatctagttcatttgcgagttgcatttatctccccctagatcttgtgtcagagttggtgaggatgggatggttcaccattgatt |
11805335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 17 - 118
Target Start/End: Original strand, 11805092 - 11805193
Alignment:
| Q |
17 |
atctccacacaaaaatgttcacacaaaaatagcttgcaaataaaatggcacacatccaaacccagtgttgtattttcatctttgaataattgaatctatc |
116 |
Q |
| |
|
||||||||| |||| || ||| ||||||||||||||| || ||||||||||||||||||||||| | || ||||| |||||||||||||||| || |||| |
|
|
| T |
11805092 |
atctccacataaaattgatcaaacaaaaatagcttgccaacaaaatggcacacatccaaacccaatattctatttccatctttgaataattggatatatc |
11805191 |
T |
|
| Q |
117 |
ta |
118 |
Q |
| |
|
|| |
|
|
| T |
11805192 |
ta |
11805193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 104
Target Start/End: Original strand, 11820510 - 11820595
Alignment:
| Q |
19 |
ctccacacaaaaatgttcacacaaaaatagcttgcaaataaaatggcacacatccaaacccagtgttgtattttcatctttgaata |
104 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||| || |||||||||||||||| |||||| |||||| | |||||||||||| |
|
|
| T |
11820510 |
ctccacacaaaaatattaacacaaaaatagcttgccaacaaaatggcacacatccgaacccaaaattgtatatccatctttgaata |
11820595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University