View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3734_high_11 (Length: 257)
Name: NF3734_high_11
Description: NF3734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3734_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 16794850 - 16794617
Alignment:
| Q |
18 |
acaatatgtagcaaccggtcaagttgattgtgatcttctttgtgcttcacatgttatgttgggtgaggttgctaatgatgctaagaaagaaaaagattct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16794850 |
acaatatgtagcaaccggtcaagttgattgtgatcttctttgtgcttcacatgttatgttgggtgaggttgctaatgatgctaagaaagaaaaagattct |
16794751 |
T |
 |
| Q |
118 |
ttttatcttaagttgttgacatcaattttgagttcaatgcaaagttggggtgagaaaaggttgcttaattatcatgagttttattctagagggactattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16794750 |
ttttatcttaagttgttgacatcaattttgagttcaatgcaaagttggggtgagaaaaggttgcttaattatcatgagttttattctagagggactattt |
16794651 |
T |
 |
| Q |
218 |
ctcaaatcgaaaatcttcttcctttgatgatgtc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
16794650 |
ctcaaatcgaaaatcttcttcctttgatgttgtc |
16794617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 48 - 194
Target Start/End: Original strand, 32733538 - 32733684
Alignment:
| Q |
48 |
tgatcttctttgtgcttcacatgttatgttgggtgaggttgctaatgatgctaagaaagaaaaagattctttttatcttaagttgttgacatcaattttg |
147 |
Q |
| |
|
||||||||||| |||||| ||||||||||| ||||||||| ||||||||||||| || || || ||||| ||| ||||| | | | || ||||| |
|
|
| T |
32733538 |
tgatcttctttcggcttcatatgttatgttgactgaggttgcaaatgatgctaagagggagaaggaatctttgtatgttaagattctttcttcggttttg |
32733637 |
T |
 |
| Q |
148 |
agttcaatgcaaagttggggtgagaaaaggttgcttaattatcatga |
194 |
Q |
| |
|
| ||||||||| ||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
32733638 |
atttcaatgcagagttgggctgagaagaggttgctcaattatcatga |
32733684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University