View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3734_high_15 (Length: 239)
Name: NF3734_high_15
Description: NF3734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3734_high_15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 34 - 239
Target Start/End: Complemental strand, 43718397 - 43718192
Alignment:
| Q |
34 |
gagcatacatttgtaattatagtcggtcatgaacttttacataattgacataccaattttatgaaaatgatgctatgcaagttatgttttaaattaaata |
133 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43718397 |
gagcgtacatttgtaattatagtcggtcatgaacttttacataattgacataccaattttatgaaaatgatgctatgcaagttatgttttaaattaaata |
43718298 |
T |
 |
| Q |
134 |
ttctgtcaagttttcatgacaaggaaaataagtcaattatatttctttggtaatctatcattttccttttctttatatgatcgaaactcccataacttgt |
233 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43718297 |
ttttgtcaagttttcatgacaaggaaaataagtcaattatatttctttggtaatctatcattttccttttctttatatgatggaaactcccataacttgt |
43718198 |
T |
 |
| Q |
234 |
tcactt |
239 |
Q |
| |
|
|||||| |
|
|
| T |
43718197 |
tcactt |
43718192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University