View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3734_low_16 (Length: 253)
Name: NF3734_low_16
Description: NF3734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3734_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 609110 - 608885
Alignment:
| Q |
19 |
atatatgtctcttttgtcttcaccaactgtatcttgtttacttttgtctctcttctaacttgaattttcatgcactttctcaatgttattaataaaagta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
609110 |
atatatgtctcttttgtcttcaccaactgtatcttgtttacttttgtctctcttctaacttgaattttcatgcactttctcaatgttattgatgaaagta |
609011 |
T |
|
| Q |
119 |
ggtttactagtaa---accttcttccacctttttcattcatggggaagattgcaacacagcctctacctcgaatggcttccaattatgatgaggttttca |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
609010 |
ggtttactagtaataaaccttcttccacctttttcattcatggggaagattgcaacacagcctctacctcgaatggcttccaattatgatgaggttttca |
608911 |
T |
|
| Q |
216 |
tgcatcaaaccttgctctttgatgat |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
608910 |
tgcatcaaaccttgctctttgatgat |
608885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University