View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3734_low_21 (Length: 230)
Name: NF3734_low_21
Description: NF3734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3734_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 16772043 - 16772260
Alignment:
| Q |
1 |
ttcacttggattgtctctgtggtggcctgaccaatcattgtatcatcatccaattcctcaagaatgagctagttattattgttactgttattctcatggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
16772043 |
ttcacttggattgtctctgtggtggcctgaccaatcattgtatcatcatccaattgctcaagaatgagctcgttattactgttactgttattctcatggg |
16772142 |
T |
|
| Q |
101 |
tttggaaggtacttgtatgagaagtgacagttttgtaattagtgctttggttggggttattttggttcggttggcttatgtgtggtggggccaaattatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16772143 |
tttggaaggtacttgtatgagaagtggcagttttgtaattagtgctttggttggggttattttggttcggttggcttatgtgtggtggggccaaattatt |
16772242 |
T |
|
| Q |
201 |
ttttgtttggtttatatt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
16772243 |
ttttgtttggtttatatt |
16772260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University