View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3734_low_22 (Length: 227)
Name: NF3734_low_22
Description: NF3734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3734_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 16794820 - 16794617
Alignment:
| Q |
18 |
tgatcttctttgtgcttcacatgttatgttgggtgaggttgctaatgatgctaagaaagaaaaagattctttttatcttaagttgttgacatcaattttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16794820 |
tgatcttctttgtgcttcacatgttatgttgggtgaggttgctaatgatgctaagaaagaaaaagattctttttatcttaagttgttgacatcaattttg |
16794721 |
T |
|
| Q |
118 |
agttcaatgcaaagttggggtgagaaaaggttgcttaattatcatgagttttattctagagggactatttctcaaatcgaaaatcttcttcctttgatga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16794720 |
agttcaatgcaaagttggggtgagaaaaggttgcttaattatcatgagttttattctagagggactatttctcaaatcgaaaatcttcttcctttgatgt |
16794621 |
T |
|
| Q |
218 |
tgtc |
221 |
Q |
| |
|
|||| |
|
|
| T |
16794620 |
tgtc |
16794617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 164
Target Start/End: Original strand, 32733538 - 32733684
Alignment:
| Q |
18 |
tgatcttctttgtgcttcacatgttatgttgggtgaggttgctaatgatgctaagaaagaaaaagattctttttatcttaagttgttgacatcaattttg |
117 |
Q |
| |
|
||||||||||| |||||| ||||||||||| ||||||||| ||||||||||||| || || || ||||| ||| ||||| | | | || ||||| |
|
|
| T |
32733538 |
tgatcttctttcggcttcatatgttatgttgactgaggttgcaaatgatgctaagagggagaaggaatctttgtatgttaagattctttcttcggttttg |
32733637 |
T |
|
| Q |
118 |
agttcaatgcaaagttggggtgagaaaaggttgcttaattatcatga |
164 |
Q |
| |
|
| ||||||||| ||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
32733638 |
atttcaatgcagagttgggctgagaagaggttgctcaattatcatga |
32733684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University