View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3734_low_7 (Length: 405)
Name: NF3734_low_7
Description: NF3734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3734_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 9e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 114 - 276
Target Start/End: Complemental strand, 10983228 - 10983066
Alignment:
| Q |
114 |
atcctttattataaaagccagacttgatgagctggcagtttgccctaaacaatcctgtttttccctcttaatctgtcattaattgcaaggcttatctgct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
10983228 |
atcctttattataaaagccagacttgatgagctggcagtttgccctaatcaatcctgattttccctcctaattcgtcattaattgcaaggcttatctgcc |
10983129 |
T |
 |
| Q |
214 |
aaccacccactacatattagcctcattaaatgtgacctttcatgtacatcaaacaaccaatca |
276 |
Q |
| |
|
||||||||||| | | || | | |||| | ||||||||||||||||||||| |||||||||| |
|
|
| T |
10983128 |
aaccacccacttcctcttgggcgcatttattgtgacctttcatgtacatcattcaaccaatca |
10983066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 161
Target Start/End: Original strand, 3081203 - 3081251
Alignment:
| Q |
114 |
atcctttattataaaagccagacttgatgagctggcagt-ttgccctaa |
161 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3081203 |
atcctttactattaaagccagacttgatgagctggcagtgttgccctaa |
3081251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 86; Significance: 5e-41; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 7 - 115
Target Start/End: Original strand, 1827532 - 1827638
Alignment:
| Q |
7 |
aaaagtaattagtattctttggtcctacaaaagagacagtgttctatggtttggtccggccttctgtaacatgttttgtttcgaacgtgttttgcaattc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
1827532 |
aaaagtaattagtattctttggtcctacaaaagaga--gtgttctatggtttggtccggccttgtgtaacatgttttgttctgaacgtgttttgcaattc |
1827629 |
T |
 |
| Q |
107 |
caaaaatat |
115 |
Q |
| |
|
||||||||| |
|
|
| T |
1827630 |
caaaaatat |
1827638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 63
Target Start/End: Original strand, 1832348 - 1832390
Alignment:
| Q |
21 |
ttctttggtcctacaaaagagacagtgttctatggtttggtcc |
63 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
1832348 |
ttctttggtcttacaaaagagacagtggtctatggtttggtcc |
1832390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 14 - 63
Target Start/End: Original strand, 1836132 - 1836181
Alignment:
| Q |
14 |
attagtattctttggtcctacaaaagagacagtgttctatggtttggtcc |
63 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
1836132 |
attagtatactttggtctaacaaaagagacagtggtctatggtttggtcc |
1836181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 112 - 180
Target Start/End: Original strand, 33365923 - 33365992
Alignment:
| Q |
112 |
atatcctttattataaaagccagacttgatgagctggcagt-ttgccctaaacaatcctgtttttccctc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||| |
|
|
| T |
33365923 |
atatcctttattataaaagccagacttgatgagctggcagtgttgccctaatcactcctgtttttccctc |
33365992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 7e-22; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 113 - 196
Target Start/End: Complemental strand, 49195534 - 49195449
Alignment:
| Q |
113 |
tatcctttattataaaagccagacttgatgagctggcagt-ttgccctaaacaatcctgtttttccct-cttaatctgtcattaat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||| | |||||||| |||||| |
|
|
| T |
49195534 |
tatcctttattataaaagccagacttgatgagctggcagtgttgccctaatcactcctgtttttccctccctaatctgtaattaat |
49195449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 112 - 161
Target Start/End: Original strand, 40908314 - 40908364
Alignment:
| Q |
112 |
atatcctttattataaaagccagacttgatgagctggcagt-ttgccctaa |
161 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40908314 |
atatcctttactataaaagccagacttgatgagctggcagtgttgccctaa |
40908364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 113 - 180
Target Start/End: Complemental strand, 12606712 - 12606644
Alignment:
| Q |
113 |
tatcctttattataaaagccagacttgatgagctggcagt-ttgccctaaacaatcctgtttttccctc |
180 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||| ||||||||| || |||| ||||||||| |
|
|
| T |
12606712 |
tatcctttactataaaagccagacttgatgtgctggcagtgttgccctaatcactccttattttccctc |
12606644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 114 - 161
Target Start/End: Original strand, 46566569 - 46566617
Alignment:
| Q |
114 |
atcctttattataaaagccagacttgatgagctggcagt-ttgccctaa |
161 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
46566569 |
atcctttattataaaagccagatttgatgagctggcagtgttgccctaa |
46566617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 114 - 196
Target Start/End: Complemental strand, 31525577 - 31525493
Alignment:
| Q |
114 |
atcctttattataaaagccagacttgatgagctggcagt-ttgccctaaacaatcctgtttttccct-cttaatctgtcattaat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||| | |||||||| |||||| |
|
|
| T |
31525577 |
atcctttattataaaagccagacttgatgagctggcagtgttgccctaatcactcctgtttttccctccctaatctgtaattaat |
31525493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 114 - 161
Target Start/End: Complemental strand, 23538293 - 23538245
Alignment:
| Q |
114 |
atcctttattataaaagccagacttgatgagctggcagt-ttgccctaa |
161 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
23538293 |
atcctttattattaaagtcagacttgatgagctagcagtgttgccctaa |
23538245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 114 - 180
Target Start/End: Original strand, 12870155 - 12870222
Alignment:
| Q |
114 |
atcctttattataaaagccagacttgatgagctggcagt-ttgccctaaacaatcctgtttttccctc |
180 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||| || | ||||||||||||| |
|
|
| T |
12870155 |
atcctttactataaaagccagacttgatgagctggcagtgttgccctaatcacttctgtttttccctc |
12870222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 114 - 161
Target Start/End: Complemental strand, 43469680 - 43469632
Alignment:
| Q |
114 |
atcctttattataaaagccagacttgatgagctggcagt-ttgccctaa |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43469680 |
atcctttattataaaagccagacttgatgagctggcagtgttgccctaa |
43469632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000009; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 114 - 161
Target Start/End: Complemental strand, 10646183 - 10646135
Alignment:
| Q |
114 |
atcctttattataaaagccagacttgatgagctggcagt-ttgccctaa |
161 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10646183 |
atcctttattctaaaagccagacttgatgagctggcagtgttgccctaa |
10646135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 63
Target Start/End: Complemental strand, 46382990 - 46382938
Alignment:
| Q |
11 |
gtaattagtattctttggtcctacaaaagagacagtgttctatggtttggtcc |
63 |
Q |
| |
|
|||||| |||| |||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
46382990 |
gtaattggtatactttggtctaacaaaagagacagtggtctatggtttggtcc |
46382938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 118 - 161
Target Start/End: Complemental strand, 4658748 - 4658704
Alignment:
| Q |
118 |
tttattataaaagccagacttgatgagctggca-gtttgccctaa |
161 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
4658748 |
tttattataaaagctagacttgatgagctagcatgtttgccctaa |
4658704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University