View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3735_low_13 (Length: 302)
Name: NF3735_low_13
Description: NF3735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3735_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 410348 - 410530
Alignment:
| Q |
1 |
cacaaccgctgatttcatatcacttcacatgcctctcactccaactactaacaaggtcttcaatgaaaacacttttgctaagatgaagaagggtgtgaga |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
410348 |
cacaaccgctgatttcatctcacttcacatgcctctcactccaactactaacaaagtcttcaatgacaacacttttgctaagatgaagaatggtgtgaga |
410447 |
T |
 |
| Q |
101 |
atcatcaatgttgctagaggtggtgttattgatgaagatgctttagtcaaagctcttgatagtggaattgttgctcaggtcaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410448 |
atcatcaatgttgctagaggtggtgttattgatgaagatgctttagtcaaagctcttgatagtggaattgttgctcaggtcaa |
410530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 207 - 287
Target Start/End: Original strand, 410600 - 410680
Alignment:
| Q |
207 |
atttgaaattaatgatttatctgttaaccattcaaatgacatttctattttgtttgaacttggagcaggcagctcttgatg |
287 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410600 |
atttgaaattaattagttatctgttaaccattcaaatgacatttctattttgtttgaacttggagcaggcagctcttgatg |
410680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University