View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3735_low_19 (Length: 218)
Name: NF3735_low_19
Description: NF3735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3735_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 7174703 - 7174906
Alignment:
| Q |
1 |
atggacaaatggcaaatgaggannnnnnngaataaataaaagtaagagatgaaattatggtgtcgtatttattttccatttcttagagactatttccttt |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7174703 |
atggacaaatggcaaatgaggatttttttgaataaataaaagtaagagatgaaattatggtgtcgtatttattttccatttcttagagactatttccttt |
7174802 |
T |
 |
| Q |
101 |
gatgttagccaacaataacaaactaacaaaccctaaaagaattactattccattgcacttgaagacaactaaaattcttattcattcatatttcacatca |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7174803 |
gatgttagccaacaa--------taacaaaccctaaaagaattactatcccattgcacttgaagacaactaaaattcttattcattcatatttcacagca |
7174894 |
T |
 |
| Q |
201 |
tcatacatcaaa |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7174895 |
tcatacatcaaa |
7174906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University