View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3735_low_20 (Length: 206)
Name: NF3735_low_20
Description: NF3735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3735_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 15 - 184
Target Start/End: Original strand, 42748683 - 42748850
Alignment:
| Q |
15 |
tattctagttgttttggttgatgtaatgtaatgagccaacacaagaatatgaatttggtggctgaaagtgaaagttttgaagtcatattttatattgcgt |
114 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42748683 |
tattctagttgttttggttgatgt-----aatgagccaacacaagaatatgaatttggtggctgaaagtgaaagttttgaagtcatattttataatgcgt |
42748777 |
T |
 |
| Q |
115 |
ggacagttacatgtgcacatttaatgaaccattgcat---tactactactactactcctgtcaagccaacaca |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42748778 |
ggacagttacatgtgcacatttaatgaaccattgcattactactactactactactcctgtcaagccaacaca |
42748850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University