View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3737_low_1 (Length: 825)
Name: NF3737_low_1
Description: NF3737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3737_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 8e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 18 - 128
Target Start/End: Complemental strand, 55170175 - 55170065
Alignment:
| Q |
18 |
atctaaagttggtgtttgtcaatgacaacataataatgttaccaaactccatcaaatgatagccttcattattcatcaacttttaaccaaatattttgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55170175 |
atctaaagttggtgtttgtcaatgacaaaacaataatgttaccaaactccatcaaatgatagccttcattattcatcaacttttaaccaaatattttgga |
55170076 |
T |
 |
| Q |
118 |
aacggttcagg |
128 |
Q |
| |
|
||||||||||| |
|
|
| T |
55170075 |
aacggttcagg |
55170065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University