View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3739_high_12 (Length: 445)
Name: NF3739_high_12
Description: NF3739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3739_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 1e-54; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 56 - 178
Target Start/End: Complemental strand, 44313120 - 44313001
Alignment:
| Q |
56 |
ttttagtcctaggagtttaaattatgttgattaaagttaaatgatgtaagcatgattgtctctaattgtaataatatagaaaagattttatgcaaagaag |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44313120 |
ttttagtcctaggagtttaaattatgttgattaaagttaaatgatgtaagcatgattgtctctaattgt---aatatagaaaagattttatgcaaagaag |
44313024 |
T |
 |
| Q |
156 |
catgatttttattttatcaattt |
178 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44313023 |
catgatttttattttatcaattt |
44313001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 268 - 391
Target Start/End: Complemental strand, 44312883 - 44312759
Alignment:
| Q |
268 |
gctgctagatagattgaaattaaggctgaatttatttattgtagtgaggtaattagcgattttttgtatcccacgaaa-tgataattgataagaaaatga |
366 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44312883 |
gctgcgagagagattgaaattaaggctgaatttatttatagtggtgaggtaattagcgattttttgtatcccacgaaattgataattgataagaaaatga |
44312784 |
T |
 |
| Q |
367 |
aatagaaaattatggattcttctct |
391 |
Q |
| |
|
|||||||||||||| |||||||||| |
|
|
| T |
44312783 |
aatagaaaattatgcattcttctct |
44312759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 252 - 289
Target Start/End: Complemental strand, 44312929 - 44312892
Alignment:
| Q |
252 |
cgttaggaagagcgaggctgctagatagattgaaatta |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44312929 |
cgttaggaagagcgaggctgctagatagattgaaatta |
44312892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University