View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3739_high_24 (Length: 259)

Name: NF3739_high_24
Description: NF3739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3739_high_24
NF3739_high_24
[»] chr2 (1 HSPs)
chr2 (14-244)||(5769510-5769740)


Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 244
Target Start/End: Original strand, 5769510 - 5769740
Alignment:
14 tcatcagcaaccactgcagcatagaaatagttcttnnnnnnntttattcttaaatttgcataaattagaacaattttccagaattattggtttacataat 113  Q
    |||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
5769510 tcatcagcaaccactgcagcatagaaatagttcttaaaaaaatttattcttaaatttgcataaattagaacaattttccagaattactggtttacataat 5769609  T
114 cacaaggcatgaatgagttaaattcattttggttgcataaattgattcatttagttgcaaccccatttgattgggggaaatggaatttgggatgagacaa 213  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5769610 aacaaggcatgaatgagttaaattcattttggttgcataaattgattcatttagttgcaaccccatttgattgggggaaatggaatttgggatgagacaa 5769709  T
214 tggtgttctacgtttgacagtgatttggatc 244  Q
    |||||||||||||||||||||||||||||||    
5769710 tggtgttctacgtttgacagtgatttggatc 5769740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University